Recombinant:Article Title: Intelligent Image-Activated Cell Sorting.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD61, PE conjugated Beckman Coulter Cat#IM3605; RRID: AB_131237 Mouse monoclonal anti-EpCAM (clone VU-1D9) GeneTex Cat#GTX28667; RRID: AB_368463 Rat monoclonal anti-mouse IgG1 (clone A85-1), PE conjugated BD Biosciences Cat#550083; RRID: AB_393553 Chemicals, Peptides, and Recombinant Proteins RPMI medium 1640 Thermo Fisher Scientific (GIBCO) Cat#11875093 Fetal bovine serum Thermo Fisher Scientific (GIBCO) Cat#10270 106 SYTO16 Thermo Fisher Scientific (Invitrogen) Cat#S7578 Glutaraldehyde (25% solution) Nacalai tesque, Kyoto, Japan Cat#17003-92 TRAP-6 amide trifluoroacetate salt BACHEM Cat#H-2936.0005 Hygromycin Wako Cat#085-06153 Paromomycin Wako Cat#161-23603 Bovine serum albumin solution Sigma Cat#A9576 Critical Commercial Assays EasyComp fluorescent particle kit (Blank, FITC, PE & PE-Cy5), 4 vials Spherotech Cat#ECFP-K1 Rainbow fluorescent particles, 6.0-6.4 mm Spherotech Cat#RFP-60-5 Rainbow calibration particles, 6 peaks Spherotech Cat#RCP-30-5 (6 peaks) Polystyrene particle size standard kit, flow cytometry grade Spherotech Cat#PPS-6K Lysing buffer (10X concentrated), BD pharm lyse BD Biosciences Cat#555899 OptiLyse C Beckman Coulter Cat#A11895 PrimeSTAR GXL DNA polymerase Takara Bio Cat#R050A In-Fusion HD cloning kit Takara Bio Cat#639648 MAX efficiency transformation reagent for algae Thermo Fisher Scientific (Invitrogen) Cat#A24229 Deposited Data Raw data and custom codes This paper http://www.goda.chem.s.u-tokyo.ac.jp/ intelligentIACS/software.zip Experimental Models: Cell Lines Human adenocarcinoma: H1975 cells ATCC Cat#CRL-5908 Experimental Models: Organisms/Strains Euglena gracilis NIES-48 Microbial Culture Collection at NIES NIES-48 Chlorella sorokiniana TKAC1027 Tsuruoka, Keio, Algae Collection TKAC1027 Chlamydomonas reinhardtii TKAC1017 Tsuruoka, Keio, Algae Collection TKAC1017 Chlamydomonas reinhardtii C-9 Microbial Culture Collection at NIES NIES-2235 Chlamydomonas reinhardtii BC-9 This paper N/A Haematococcus lacustris NIES-4141 Microbial Culture Collection at NIES NIES-4141 Gloeomonas anomalipyrenoides NIES-3640 Microbial Culture Collection at NIES NIES-3640 Oligonucleotides Primer: LCIB-N-fusion-F (forward): TTTGCAGGATGCATATGTTCGCTCTGTCTTCGCGC This paper N/A Primer: LCIB-N-fusion-R (reverse): CGATGACGTCAGATCTGTTCTTGGGGGCCTCGAA This paper N/A (Continued on next page) e1 Cell 175, 1–11.e1–e8, September 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer: aph-F1 (forward): GCTTATCGATACCGTCGACCT This paper N/A Primer: aph-R3 (reverse): AACACCATCAGGTCCCTCAG This paper N/A Recombinant DNA pOpt_Clover_Hyg vector Lauersen et al., 2015; GenBank KM061067.2 LCIB-Clover expression plasmid This paper N/A pGenD-aphVIII Nakazawa et al., 2007, personally provided N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij TensorFlow Abadi et al., 2016 https://arxiv.org/abs/1603.04467 Keras Chollet, 2015 https://github.com/keras-team/keras R R Core Team, 2016 https://www.R-project.org/ OpenCV Bradski, 2000 https://opencv.org/ LabVIEW National Instruments http://www.ni.com/labview/ Please cite this article in press as: Nitta et al., Intelligent Image-Activated Cell Sorting, Cell (2018), https://doi.org/10.1016/j.cell.2018.08.028
Flow Cytometry:Article Title: Intelligent Image-Activated Cell Sorting.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD61, PE conjugated Beckman Coulter Cat#IM3605; RRID: AB_131237 Mouse monoclonal anti-EpCAM (clone VU-1D9) GeneTex Cat#GTX28667; RRID: AB_368463 Rat monoclonal anti-mouse IgG1 (clone A85-1), PE conjugated BD Biosciences Cat#550083; RRID: AB_393553 Chemicals, Peptides, and Recombinant Proteins RPMI medium 1640 Thermo Fisher Scientific (GIBCO) Cat#11875093 Fetal bovine serum Thermo Fisher Scientific (GIBCO) Cat#10270 106 SYTO16 Thermo Fisher Scientific (Invitrogen) Cat#S7578 Glutaraldehyde (25% solution) Nacalai tesque, Kyoto, Japan Cat#17003-92 TRAP-6 amide trifluoroacetate salt BACHEM Cat#H-2936.0005 Hygromycin Wako Cat#085-06153 Paromomycin Wako Cat#161-23603 Bovine serum albumin solution Sigma Cat#A9576 Critical Commercial Assays EasyComp fluorescent particle kit (Blank, FITC, PE & PE-Cy5), 4 vials Spherotech Cat#ECFP-K1 Rainbow fluorescent particles, 6.0-6.4 mm Spherotech Cat#RFP-60-5 Rainbow calibration particles, 6 peaks Spherotech Cat#RCP-30-5 (6 peaks) Polystyrene particle size standard kit, flow cytometry grade Spherotech Cat#PPS-6K Lysing buffer (10X concentrated), BD pharm lyse BD Biosciences Cat#555899 OptiLyse C Beckman Coulter Cat#A11895 PrimeSTAR GXL DNA polymerase Takara Bio Cat#R050A In-Fusion HD cloning kit Takara Bio Cat#639648 MAX efficiency transformation reagent for algae Thermo Fisher Scientific (Invitrogen) Cat#A24229 Deposited Data Raw data and custom codes This paper http://www.goda.chem.s.u-tokyo.ac.jp/ intelligentIACS/software.zip Experimental Models: Cell Lines Human adenocarcinoma: H1975 cells ATCC Cat#CRL-5908 Experimental Models: Organisms/Strains Euglena gracilis NIES-48 Microbial Culture Collection at NIES NIES-48 Chlorella sorokiniana TKAC1027 Tsuruoka, Keio, Algae Collection TKAC1027 Chlamydomonas reinhardtii TKAC1017 Tsuruoka, Keio, Algae Collection TKAC1017 Chlamydomonas reinhardtii C-9 Microbial Culture Collection at NIES NIES-2235 Chlamydomonas reinhardtii BC-9 This paper N/A Haematococcus lacustris NIES-4141 Microbial Culture Collection at NIES NIES-4141 Gloeomonas anomalipyrenoides NIES-3640 Microbial Culture Collection at NIES NIES-3640 Oligonucleotides Primer: LCIB-N-fusion-F (forward): TTTGCAGGATGCATATGTTCGCTCTGTCTTCGCGC This paper N/A Primer: LCIB-N-fusion-R (reverse): CGATGACGTCAGATCTGTTCTTGGGGGCCTCGAA This paper N/A (Continued on next page) e1 Cell 175, 1–11.e1–e8, September 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer: aph-F1 (forward): GCTTATCGATACCGTCGACCT This paper N/A Primer: aph-R3 (reverse): AACACCATCAGGTCCCTCAG This paper N/A Recombinant DNA pOpt_Clover_Hyg vector Lauersen et al., 2015; GenBank KM061067.2 LCIB-Clover expression plasmid This paper N/A pGenD-aphVIII Nakazawa et al., 2007, personally provided N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij TensorFlow Abadi et al., 2016 https://arxiv.org/abs/1603.04467 Keras Chollet, 2015 https://github.com/keras-team/keras R R Core Team, 2016 https://www.R-project.org/ OpenCV Bradski, 2000 https://opencv.org/ LabVIEW National Instruments http://www.ni.com/labview/ Please cite this article in press as: Nitta et al., Intelligent Image-Activated Cell Sorting, Cell (2018), https://doi.org/10.1016/j.cell.2018.08.028
Cloning:Article Title: Intelligent Image-Activated Cell Sorting.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD61, PE conjugated Beckman Coulter Cat#IM3605; RRID: AB_131237 Mouse monoclonal anti-EpCAM (clone VU-1D9) GeneTex Cat#GTX28667; RRID: AB_368463 Rat monoclonal anti-mouse IgG1 (clone A85-1), PE conjugated BD Biosciences Cat#550083; RRID: AB_393553 Chemicals, Peptides, and Recombinant Proteins RPMI medium 1640 Thermo Fisher Scientific (GIBCO) Cat#11875093 Fetal bovine serum Thermo Fisher Scientific (GIBCO) Cat#10270 106 SYTO16 Thermo Fisher Scientific (Invitrogen) Cat#S7578 Glutaraldehyde (25% solution) Nacalai tesque, Kyoto, Japan Cat#17003-92 TRAP-6 amide trifluoroacetate salt BACHEM Cat#H-2936.0005 Hygromycin Wako Cat#085-06153 Paromomycin Wako Cat#161-23603 Bovine serum albumin solution Sigma Cat#A9576 Critical Commercial Assays EasyComp fluorescent particle kit (Blank, FITC, PE & PE-Cy5), 4 vials Spherotech Cat#ECFP-K1 Rainbow fluorescent particles, 6.0-6.4 mm Spherotech Cat#RFP-60-5 Rainbow calibration particles, 6 peaks Spherotech Cat#RCP-30-5 (6 peaks) Polystyrene particle size standard kit, flow cytometry grade Spherotech Cat#PPS-6K Lysing buffer (10X concentrated), BD pharm lyse BD Biosciences Cat#555899 OptiLyse C Beckman Coulter Cat#A11895 PrimeSTAR GXL DNA polymerase Takara Bio Cat#R050A In-Fusion HD cloning kit Takara Bio Cat#639648 MAX efficiency transformation reagent for algae Thermo Fisher Scientific (Invitrogen) Cat#A24229 Deposited Data Raw data and custom codes This paper http://www.goda.chem.s.u-tokyo.ac.jp/ intelligentIACS/software.zip Experimental Models: Cell Lines Human adenocarcinoma: H1975 cells ATCC Cat#CRL-5908 Experimental Models: Organisms/Strains Euglena gracilis NIES-48 Microbial Culture Collection at NIES NIES-48 Chlorella sorokiniana TKAC1027 Tsuruoka, Keio, Algae Collection TKAC1027 Chlamydomonas reinhardtii TKAC1017 Tsuruoka, Keio, Algae Collection TKAC1017 Chlamydomonas reinhardtii C-9 Microbial Culture Collection at NIES NIES-2235 Chlamydomonas reinhardtii BC-9 This paper N/A Haematococcus lacustris NIES-4141 Microbial Culture Collection at NIES NIES-4141 Gloeomonas anomalipyrenoides NIES-3640 Microbial Culture Collection at NIES NIES-3640 Oligonucleotides Primer: LCIB-N-fusion-F (forward): TTTGCAGGATGCATATGTTCGCTCTGTCTTCGCGC This paper N/A Primer: LCIB-N-fusion-R (reverse): CGATGACGTCAGATCTGTTCTTGGGGGCCTCGAA This paper N/A (Continued on next page) e1 Cell 175, 1–11.e1–e8, September 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer: aph-F1 (forward): GCTTATCGATACCGTCGACCT This paper N/A Primer: aph-R3 (reverse): AACACCATCAGGTCCCTCAG This paper N/A Recombinant DNA pOpt_Clover_Hyg vector Lauersen et al., 2015; GenBank KM061067.2 LCIB-Clover expression plasmid This paper N/A pGenD-aphVIII Nakazawa et al., 2007, personally provided N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij TensorFlow Abadi et al., 2016 https://arxiv.org/abs/1603.04467 Keras Chollet, 2015 https://github.com/keras-team/keras R R Core Team, 2016 https://www.R-project.org/ OpenCV Bradski, 2000 https://opencv.org/ LabVIEW National Instruments http://www.ni.com/labview/ Please cite this article in press as: Nitta et al., Intelligent Image-Activated Cell Sorting, Cell (2018), https://doi.org/10.1016/j.cell.2018.08.028
Transformation Assay:Article Title: Intelligent Image-Activated Cell Sorting.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD61, PE conjugated Beckman Coulter Cat#IM3605; RRID: AB_131237 Mouse monoclonal anti-EpCAM (clone VU-1D9) GeneTex Cat#GTX28667; RRID: AB_368463 Rat monoclonal anti-mouse IgG1 (clone A85-1), PE conjugated BD Biosciences Cat#550083; RRID: AB_393553 Chemicals, Peptides, and Recombinant Proteins RPMI medium 1640 Thermo Fisher Scientific (GIBCO) Cat#11875093 Fetal bovine serum Thermo Fisher Scientific (GIBCO) Cat#10270 106 SYTO16 Thermo Fisher Scientific (Invitrogen) Cat#S7578 Glutaraldehyde (25% solution) Nacalai tesque, Kyoto, Japan Cat#17003-92 TRAP-6 amide trifluoroacetate salt BACHEM Cat#H-2936.0005 Hygromycin Wako Cat#085-06153 Paromomycin Wako Cat#161-23603 Bovine serum albumin solution Sigma Cat#A9576 Critical Commercial Assays EasyComp fluorescent particle kit (Blank, FITC, PE & PE-Cy5), 4 vials Spherotech Cat#ECFP-K1 Rainbow fluorescent particles, 6.0-6.4 mm Spherotech Cat#RFP-60-5 Rainbow calibration particles, 6 peaks Spherotech Cat#RCP-30-5 (6 peaks) Polystyrene particle size standard kit, flow cytometry grade Spherotech Cat#PPS-6K Lysing buffer (10X concentrated), BD pharm lyse BD Biosciences Cat#555899 OptiLyse C Beckman Coulter Cat#A11895 PrimeSTAR GXL DNA polymerase Takara Bio Cat#R050A In-Fusion HD cloning kit Takara Bio Cat#639648 MAX efficiency transformation reagent for algae Thermo Fisher Scientific (Invitrogen) Cat#A24229 Deposited Data Raw data and custom codes This paper http://www.goda.chem.s.u-tokyo.ac.jp/ intelligentIACS/software.zip Experimental Models: Cell Lines Human adenocarcinoma: H1975 cells ATCC Cat#CRL-5908 Experimental Models: Organisms/Strains Euglena gracilis NIES-48 Microbial Culture Collection at NIES NIES-48 Chlorella sorokiniana TKAC1027 Tsuruoka, Keio, Algae Collection TKAC1027 Chlamydomonas reinhardtii TKAC1017 Tsuruoka, Keio, Algae Collection TKAC1017 Chlamydomonas reinhardtii C-9 Microbial Culture Collection at NIES NIES-2235 Chlamydomonas reinhardtii BC-9 This paper N/A Haematococcus lacustris NIES-4141 Microbial Culture Collection at NIES NIES-4141 Gloeomonas anomalipyrenoides NIES-3640 Microbial Culture Collection at NIES NIES-3640 Oligonucleotides Primer: LCIB-N-fusion-F (forward): TTTGCAGGATGCATATGTTCGCTCTGTCTTCGCGC This paper N/A Primer: LCIB-N-fusion-R (reverse): CGATGACGTCAGATCTGTTCTTGGGGGCCTCGAA This paper N/A (Continued on next page) e1 Cell 175, 1–11.e1–e8, September 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer: aph-F1 (forward): GCTTATCGATACCGTCGACCT This paper N/A Primer: aph-R3 (reverse): AACACCATCAGGTCCCTCAG This paper N/A Recombinant DNA pOpt_Clover_Hyg vector Lauersen et al., 2015; GenBank KM061067.2 LCIB-Clover expression plasmid This paper N/A pGenD-aphVIII Nakazawa et al., 2007, personally provided N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij TensorFlow Abadi et al., 2016 https://arxiv.org/abs/1603.04467 Keras Chollet, 2015 https://github.com/keras-team/keras R R Core Team, 2016 https://www.R-project.org/ OpenCV Bradski, 2000 https://opencv.org/ LabVIEW National Instruments http://www.ni.com/labview/ Please cite this article in press as: Nitta et al., Intelligent Image-Activated Cell Sorting, Cell (2018), https://doi.org/10.1016/j.cell.2018.08.028
Algae:Article Title: Intelligent Image-Activated Cell Sorting.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-CD61, PE conjugated Beckman Coulter Cat#IM3605; RRID: AB_131237 Mouse monoclonal anti-EpCAM (clone VU-1D9) GeneTex Cat#GTX28667; RRID: AB_368463 Rat monoclonal anti-mouse IgG1 (clone A85-1), PE conjugated BD Biosciences Cat#550083; RRID: AB_393553 Chemicals, Peptides, and Recombinant Proteins RPMI medium 1640 Thermo Fisher Scientific (GIBCO) Cat#11875093 Fetal bovine serum Thermo Fisher Scientific (GIBCO) Cat#10270 106 SYTO16 Thermo Fisher Scientific (Invitrogen) Cat#S7578 Glutaraldehyde (25% solution) Nacalai tesque, Kyoto, Japan Cat#17003-92 TRAP-6 amide trifluoroacetate salt BACHEM Cat#H-2936.0005 Hygromycin Wako Cat#085-06153 Paromomycin Wako Cat#161-23603 Bovine serum albumin solution Sigma Cat#A9576 Critical Commercial Assays EasyComp fluorescent particle kit (Blank, FITC, PE & PE-Cy5), 4 vials Spherotech Cat#ECFP-K1 Rainbow fluorescent particles, 6.0-6.4 mm Spherotech Cat#RFP-60-5 Rainbow calibration particles, 6 peaks Spherotech Cat#RCP-30-5 (6 peaks) Polystyrene particle size standard kit, flow cytometry grade Spherotech Cat#PPS-6K Lysing buffer (10X concentrated), BD pharm lyse BD Biosciences Cat#555899 OptiLyse C Beckman Coulter Cat#A11895 PrimeSTAR GXL DNA polymerase Takara Bio Cat#R050A In-Fusion HD cloning kit Takara Bio Cat#639648 MAX efficiency transformation reagent for algae Thermo Fisher Scientific (Invitrogen) Cat#A24229 Deposited Data Raw data and custom codes This paper http://www.goda.chem.s.u-tokyo.ac.jp/ intelligentIACS/software.zip Experimental Models: Cell Lines Human adenocarcinoma: H1975 cells ATCC Cat#CRL-5908 Experimental Models: Organisms/Strains Euglena gracilis NIES-48 Microbial Culture Collection at NIES NIES-48 Chlorella sorokiniana TKAC1027 Tsuruoka, Keio, Algae Collection TKAC1027 Chlamydomonas reinhardtii TKAC1017 Tsuruoka, Keio, Algae Collection TKAC1017 Chlamydomonas reinhardtii C-9 Microbial Culture Collection at NIES NIES-2235 Chlamydomonas reinhardtii BC-9 This paper N/A Haematococcus lacustris NIES-4141 Microbial Culture Collection at NIES NIES-4141 Gloeomonas anomalipyrenoides NIES-3640 Microbial Culture Collection at NIES NIES-3640 Oligonucleotides Primer: LCIB-N-fusion-F (forward): TTTGCAGGATGCATATGTTCGCTCTGTCTTCGCGC This paper N/A Primer: LCIB-N-fusion-R (reverse): CGATGACGTCAGATCTGTTCTTGGGGGCCTCGAA This paper N/A (Continued on next page) e1 Cell 175, 1–11.e1–e8, September 20, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primer: aph-F1 (forward): GCTTATCGATACCGTCGACCT This paper N/A Primer: aph-R3 (reverse): AACACCATCAGGTCCCTCAG This paper N/A Recombinant DNA pOpt_Clover_Hyg vector Lauersen et al., 2015; GenBank KM061067.2 LCIB-Clover expression plasmid This paper N/A pGenD-aphVIII Nakazawa et al., 2007, personally provided N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij TensorFlow Abadi et al., 2016 https://arxiv.org/abs/1603.04467 Keras Chollet, 2015 https://github.com/keras-team/keras R R Core Team, 2016 https://www.R-project.org/ OpenCV Bradski, 2000 https://opencv.org/ LabVIEW National Instruments http://www.ni.com/labview/ Please cite this article in press as: Nitta et al., Intelligent Image-Activated Cell Sorting, Cell (2018), https://doi.org/10.1016/j.cell.2018.08.028
|
